View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14014_low_18 (Length: 250)

Name: NF14014_low_18
Description: NF14014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14014_low_18
NF14014_low_18
[»] chr4 (2 HSPs)
chr4 (94-250)||(51351487-51351643)
chr4 (9-80)||(51351901-51351971)


Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 94 - 250
Target Start/End: Complemental strand, 51351643 - 51351487
Alignment:
94 ggaaaatgaacgcttttagcttttaacataaaaacattgtcacttcacttcacactcaattatgtttgagtgagtattcgtcaaatataattttgaattg 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
51351643 ggaaaatgaacgcttttagcttttaacataaaaacattgtcacttcacttcacactcaattatgtttgagtgattattcgtcaaatataattttgaattg 51351544  T
194 aatagattttgtaacactgaatttaaagtgaaattatgtatcaactaaacagtgaaa 250  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
51351543 aatagattttgtaaccctgaatttaaagtgaaattatgtatcaactaaacagtgaaa 51351487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 9 - 80
Target Start/End: Complemental strand, 51351971 - 51351901
Alignment:
9 gagaagaaagcatgagacttgaacaaacactcgaaacatgcacacaaacaagtaacaaacattttttcccaa 80  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
51351971 gagaagaaagcatgagacttgaacaaacactcgaaacatgcacacaaacaagtaac-aacattttttcccaa 51351901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University