View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14014_low_25 (Length: 218)
Name: NF14014_low_25
Description: NF14014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14014_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 16 - 202
Target Start/End: Original strand, 1537716 - 1537908
Alignment:
| Q |
16 |
aatatcacacagcatttgaatttctttggattagcggctcc---tcctcct---ccacctcaggtttctgatcaaagcagtagcaaaaccacttattgtg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |||||||| ||| ||||||||||||||| |||||||| |
|
|
| T |
1537716 |
aatatcacacagcatttgaatttctttggattagcggctcctcctcctcctccaccacctcaagtttctgaccaatgcagtagcaaaaccagttattgtg |
1537815 |
T |
 |
| Q |
110 |
gttacagtagtggtaacaaccaccacaacagtaaccacaacagtaacagatgacagctattatcccccaaaacagataacttatcccagtaac |
202 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1537816 |
gttacagtactggtaacaaccaccacaacagtaaccacaacagtaacagatgacagctattatcccccaaaacagataacttatcccagtaac |
1537908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 52; Significance: 5e-21; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 143 - 202
Target Start/End: Complemental strand, 10164737 - 10164678
Alignment:
| Q |
143 |
accacaacagtaacagatgacagctattatcccccaaaacagataacttatcccagtaac |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
10164737 |
accacaacagtaacagatgacagctattatcccccaaaacagacatcttatcccagtaac |
10164678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 144
Target Start/End: Complemental strand, 10164766 - 10164724
Alignment:
| Q |
102 |
ttattgtggttacagtagtggtaacaaccaccacaacagtaac |
144 |
Q |
| |
|
||||||||| |||| || ||||||||||||||||||||||||| |
|
|
| T |
10164766 |
ttattgtggctacaatattggtaacaaccaccacaacagtaac |
10164724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University