View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14016_high_5 (Length: 328)
Name: NF14016_high_5
Description: NF14016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14016_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 67; Significance: 9e-30; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 24 - 94
Target Start/End: Original strand, 21082653 - 21082723
Alignment:
| Q |
24 |
atttgtgaatttcctccaattttggattgttatttcgttttcaaaggttgattttgaaatagatctgtgat |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21082653 |
atttgtgaatttcctccaattttggattgttatttcgttttcaaaggtagattttgaaatagatctgtgat |
21082723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 116 - 160
Target Start/End: Original strand, 21082723 - 21082767
Alignment:
| Q |
116 |
tttaaaattgggatttacttactccattctgggtaaaactgctgt |
160 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21082723 |
tttagaattgggatttacgtactccattctgggtaaaactgctgt |
21082767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 225 - 263
Target Start/End: Original strand, 21082832 - 21082870
Alignment:
| Q |
225 |
tttgaaaagggtcattgtgttttagttgtttacttttgt |
263 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21082832 |
tttgaaaagggtcattttgttttagttgtttacttttgt |
21082870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 81 - 127
Target Start/End: Complemental strand, 42078114 - 42078068
Alignment:
| Q |
81 |
aatagatctgtgatgaatgtattaaagtttcgatttttaaaattggg |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
42078114 |
aatagatctgtgatgaatgtattaaagtttggatttttagaattggg |
42078068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 82 - 127
Target Start/End: Complemental strand, 787408 - 787363
Alignment:
| Q |
82 |
atagatctgtgatgaatgtattaaagtttcgatttttaaaattggg |
127 |
Q |
| |
|
|||||| |||||||||||||| ||||||| |||||||| ||||||| |
|
|
| T |
787408 |
atagatatgtgatgaatgtatcaaagtttggatttttagaattggg |
787363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University