View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14016_low_10 (Length: 305)
Name: NF14016_low_10
Description: NF14016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14016_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 59 - 304
Target Start/End: Original strand, 14083226 - 14083471
Alignment:
| Q |
59 |
tatgaaaatgaattcacatttatacccattgtatataatttagagcgttcatagacactttagaattacttgtgcaatcatattttattcttcgagttta |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14083226 |
tatgaaaatgaattcacatttatacccattgtatataatttagagtgttcatagacactttagaattacttgtgcaatcatattttattcttcgagttta |
14083325 |
T |
|
| Q |
159 |
agttttgcaggatcccttaacacaagatctcacaaaatttatatcagttatgatggatatatcatatatggattagaaagtaactatagagtaaattttt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
14083326 |
agttttgcaggatcccttaacacaagatctcacaaaatttatatcaggtaggatggatatatcatatatggattggaaagtaattatagagtaaattttt |
14083425 |
T |
|
| Q |
259 |
gtttcataatactacgtgtaattgaaaaaatttcctcccccctcgt |
304 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14083426 |
gtttcataatactatgtgtaattgaaaaaatttcctcccccctcgt |
14083471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 12 - 62
Target Start/End: Original strand, 14082764 - 14082814
Alignment:
| Q |
12 |
atgaatctaaaatgagtgtagagttcgcttcaaggtttctaaagtattatg |
62 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14082764 |
atgaatctaaaatgagtgtatagttcgcttcaaggtttctaaagtattatg |
14082814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University