View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14016_low_13 (Length: 258)
Name: NF14016_low_13
Description: NF14016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14016_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 248
Target Start/End: Original strand, 52785637 - 52785866
Alignment:
| Q |
19 |
tgatgaatatatagatggatcaaaatcaaaatgcttcattattttcaacttctttgggttcttgttgattacaattcttctgtgtttaggggctttcaat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52785637 |
tgatgaatatatagatggatcaaaatcaaaatgcttcattattttcaacttctttgggttcttgttgattacaattcttctgtgtttaggggctttcaac |
52785736 |
T |
 |
| Q |
119 |
agtcttattgatctatttgcatctgcaaagttgaaagtaagaggtttttgagttgtgaactcactatcgtatcaaatttatttgatctcaataacataat |
218 |
Q |
| |
|
|| |||||||||||||||||||||||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52785737 |
agccttattgatctatttgcatctgcaaagtggaaagtaagaggcttttgagttctgaactcactatcgtatcaaatttatttgatctcaataacataat |
52785836 |
T |
 |
| Q |
219 |
gcagttgcaactatattttggtgccctttg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
52785837 |
gcagttgcaactatattttggtgccctttg |
52785866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University