View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14016_low_15 (Length: 251)
Name: NF14016_low_15
Description: NF14016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14016_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 64; Significance: 4e-28; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 30654410 - 30654510
Alignment:
| Q |
1 |
ttcaaggacgagttatctctactgtcgtgttttctcgactacaagcatgaatttgnnnnnnnggttgggtctatgatggttctcatcttccgaaactgcc |
100 |
Q |
| |
|
||||||||||||||| | ||| |||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30654410 |
ttcaaggacgagttaccactattgtcgtgttttctcgactacgagcatgaatttgtttttttggttgggtctatgatggttctcatcttccgaaactgcc |
30654509 |
T |
|
| Q |
101 |
a |
101 |
Q |
| |
|
| |
|
|
| T |
30654510 |
a |
30654510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 168 - 251
Target Start/End: Original strand, 30654575 - 30654658
Alignment:
| Q |
168 |
gaggagttatccccgtttacatatcgatcagggtttcgttttgttgcctaacactactcgctgtcaaacctttggacaaatttt |
251 |
Q |
| |
|
||||||||||||||| |||||||| |||||||| || ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30654575 |
gaggagttatccccgattacatatagatcagggattagttttgttgcctaacactactcgatgtcaaacctttggacaaatttt |
30654658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 196 - 248
Target Start/End: Complemental strand, 4376975 - 4376923
Alignment:
| Q |
196 |
cagggtttcgttttgttgcctaacactactcgctgtcaaacctttggacaaat |
248 |
Q |
| |
|
||||| || ||||||||||||||||||||| | ||||| | |||||||||||| |
|
|
| T |
4376975 |
cagggattggttttgttgcctaacactactagatgtcatagctttggacaaat |
4376923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University