View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14016_low_17 (Length: 249)
Name: NF14016_low_17
Description: NF14016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14016_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 100; Significance: 1e-49; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 133 - 232
Target Start/End: Original strand, 31864111 - 31864210
Alignment:
| Q |
133 |
taattgcaatagaattagtttctttaaatgtaatttggagaactttttatctacaagagtttgtgattaacaagtagttctcaatgcttagatgtatatt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31864111 |
taattgcaatagaattagtttctttaaatgtaatttggagaactttttatctacaagagtttgtgattaacaagtagttctcaatgcttagatgtatatt |
31864210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 133 - 232
Target Start/End: Original strand, 31930483 - 31930583
Alignment:
| Q |
133 |
taattgcaatagaattagtttctttaaatgtaatttggagaacttttt-atctacaagagtttgtgattaacaagtagttctcaatgcttagatgtatat |
231 |
Q |
| |
|
||||| ||||||||| | |||||||||||||||| ||||| ||||| ||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31930483 |
taattacaatagaataatcttctttaaatgtaattcggagacttttttgatccacaaatgtttgtgattaacaagtagttctcaatgcttagatgtatat |
31930582 |
T |
|
| Q |
232 |
t |
232 |
Q |
| |
|
| |
|
|
| T |
31930583 |
t |
31930583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 133 - 232
Target Start/End: Original strand, 31898428 - 31898524
Alignment:
| Q |
133 |
taattgcaatagaattagtttctttaaatgtaatttggagaactttttatctacaagagtttgtgattaacaagtagttctcaatgcttagatgtatatt |
232 |
Q |
| |
|
|||||||||||| || | ||||||||||||||||| | ||| |||| ||| | ||| |||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
31898428 |
taattgcaatagcataattttctttaaatgtaattagcagactttttgatccaaaagtgtttgtgattaaca---agttctcaatgcgtagatgtatatt |
31898524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University