View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14016_low_19 (Length: 231)
Name: NF14016_low_19
Description: NF14016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14016_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 90 - 227
Target Start/End: Complemental strand, 5789553 - 5789416
Alignment:
| Q |
90 |
agatccaaaaaacattaccaacatataaaaaacacaagatctatatggtctataagacaacacaaaacaaaataaccttagttttctaaaacaaaacctt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5789553 |
agatccaaaaaacattaccaacatataaaaaacacaagatctatatggtctataagacaacataaaacaaaacaaccttagttttctaaaacaaaacctt |
5789454 |
T |
|
| Q |
190 |
gacttgcaaacataagatggtaaaaggtttgatgatgt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5789453 |
gacttgcaaacataagatggtaaaaggtttgatgatgt |
5789416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 5789642 - 5789601
Alignment:
| Q |
1 |
ttgttcattctctctcactaatcactactgtgagctaaatag |
42 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5789642 |
ttgttcattctctctcactattcactactgtgagctaaatag |
5789601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University