View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14016_low_4 (Length: 399)
Name: NF14016_low_4
Description: NF14016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14016_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 37 - 375
Target Start/End: Original strand, 26047348 - 26047686
Alignment:
| Q |
37 |
acatcatcagaaaaccctaaacccctaaaaatctcaactttacgggaaatttcaagtgggtttaaatggaaagttctagaacaccgcaataagttagcta |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26047348 |
acatcatcagaaaaccctaaacccctaaaaatctcaattttacgggaaatttcaagtgggtttaaatggaaagttctagaacaccgcaataagttggcta |
26047447 |
T |
|
| Q |
137 |
tcatcaacggggaagggttagaaagcttggatttgaattttggaaaacccaattcccaactatgtagaaattggggttccaacacagaagggaaatcctg |
236 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
26047448 |
tcatcaacggggaagggttaaaaagcttggatttgaattttggaaaacccaattcccaactatgtagaaattggggttccaacacagaagggaaatcccg |
26047547 |
T |
|
| Q |
237 |
aacaagtgaaattaggtttttctgtggaattttgaaggaaaagagggttgttaaggattggcgaaggtgggatggatcggaattgaagaggaagtggttt |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26047548 |
aacaagtgaaattaggtttttctgtggaattttgaaggaaaagagggttgttaaggattggcgaaggtgggatggatcggaattgaagaggaagtggttt |
26047647 |
T |
|
| Q |
337 |
ttggagaggaaatggggaagagaagaggaagggaaaccg |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26047648 |
ttggagaggaaatggggaagagaagaggaagggaaaccg |
26047686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University