View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14016_low_7 (Length: 319)

Name: NF14016_low_7
Description: NF14016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14016_low_7
NF14016_low_7
[»] chr2 (2 HSPs)
chr2 (39-281)||(9411878-9412120)
chr2 (87-163)||(1029903-1029979)
[»] chr4 (1 HSPs)
chr4 (87-197)||(55894913-55895023)


Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 39 - 281
Target Start/End: Complemental strand, 9412120 - 9411878
Alignment:
39 tttaaaggatttgaagcattggaggtgtctgcagcagatcgctacgataactggaagcatgcatacaccggcattattgcagcattgggtggtgttgctg 138  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
9412120 tttaaaggatttgaagcattggaggtgtctgcagcagatcgctacgataactggaagcatgcatacaccggcattatcgcagcattgggtggtgttgctg 9412021  T
139 tacttttggaagcttacacatggatcattgtgatcaagaggaagaaatcagagaacaagttgcaaggaatgaatggaacaaatggtaatggatatggttc 238  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9412020 tacttttggaagcttacacatggatcattgtgatcaagaggaagaaatcagagaacaagttgcaaggaatgaatggaacaaatggtaatggatatggttc 9411921  T
239 tagggtgtaggatactgagatagatatagatacttgattttgg 281  Q
    |||||||||||||||||||||||||||||||||| ||||||||    
9411920 tagggtgtaggatactgagatagatatagatactggattttgg 9411878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 87 - 163
Target Start/End: Original strand, 1029903 - 1029979
Alignment:
87 aactggaagcatgcatacaccggcattattgcagcattgggtggtgttgctgtacttttggaagcttacacatggat 163  Q
    |||||||||||||| ||||  || |||||||  || ||||| ||  ||||||| ||||||||||||||||| |||||    
1029903 aactggaagcatgcttacattggtattattggtgctttggggggcattgctgtccttttggaagcttacacgtggat 1029979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 87 - 197
Target Start/End: Complemental strand, 55895023 - 55894913
Alignment:
87 aactggaagcatgcatacaccggcattattgcagcattgggtggtgttgctgtacttttggaagcttacacatggatcattgtgatcaagaggaagaaat 186  Q
    |||||||||||||| ||||  || |||||||  || ||||| ||  ||||||| ||||||||||||||||| |||||  |    || ||||||||||||     
55895023 aactggaagcatgcttacattggtattattggtgctttggggggcattgctgtccttttggaagcttacacgtggatggtatgcatgaagaggaagaaag 55894924  T
187 cagagaacaag 197  Q
    |||||||||||    
55894923 cagagaacaag 55894913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University