View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14018_high_20 (Length: 312)
Name: NF14018_high_20
Description: NF14018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14018_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 45 - 286
Target Start/End: Complemental strand, 35410092 - 35409851
Alignment:
| Q |
45 |
ccagatgccactcagccacatggcattagactacttactgaagattatccttatgcggctgatggactacccatatggactagtatagagaagttggtca |
144 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| | ||||||| ||||||||||||||||||||| |
|
|
| T |
35410092 |
ccagatgccactcggccacatggcattagactacttattgaagattatccttatgcggctgatggactcctcatatggtctagtatagagaagttggtca |
35409993 |
T |
|
| Q |
145 |
ggacctgtgtgaaccattactacaaagatttaaatgccgtttcttctgacaatgaactccagtcctggtacaaagaattcatcaacatggggcaccctga |
244 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409992 |
ggacctatgtgaaccattactacaaagatttgaatgccatttcttctgacaatgaactccagtcctggtacaaagaattcatcaacatggggcaccctga |
35409893 |
T |
|
| Q |
245 |
tcataaaaatgctacctggtggcctaaactaaacacccctga |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409892 |
tcataaaaatgctacctggtggcctaaactaaacacccctga |
35409851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University