View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14018_high_9 (Length: 391)
Name: NF14018_high_9
Description: NF14018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14018_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 342; Significance: 0; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 29 - 378
Target Start/End: Original strand, 42280276 - 42280625
Alignment:
| Q |
29 |
aacaacaacacaaggttttgactcccttggagctagatgccagcagtattacaaagctggagcgcggtttgccaagtggcgtgcggtcctcaagattggt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42280276 |
aacaacaacacaaggttttgactcccttggagctagatgccagcagtattacaaagctggagcgcggtttgccaagtggcgtgcggtcctcaagattggt |
42280375 |
T |
|
| Q |
129 |
cccaatgagccctctgagttgtctatccagcaaaatgcacagggcttggctcgctacgccatcatttgccaggagaatggccttgtgcctattgttgagc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42280376 |
cccaatgagccctctgagttgtctatccagcaaaatgcacagggcttggctcgctacgccatcatttgccaggagaatggccttgtgcctattgttgagc |
42280475 |
T |
|
| Q |
229 |
ctgagattttaaccgatggatctcatgacatcgccaaatgcgccgctgtcactgaaactgtgcttgcagctgtttacaaggcactgaatgatcagcatgt |
328 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42280476 |
ctgagattttaaccgatggatctcatgacatcgccaaatgcgccgctgtcactgaaactgtacttgcagctgtttacaaggcactgaatgatcagcatgt |
42280575 |
T |
|
| Q |
329 |
ccttcttgaaggaactcttctcaagcctaacatggttaccacaggttctg |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42280576 |
ccttcttgaaggaactcttctcaagcctaacatggttaccccaggttctg |
42280625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 303 - 368
Target Start/End: Complemental strand, 29237364 - 29237299
Alignment:
| Q |
303 |
tacaaggcactgaatgatcagcatgtccttcttgaaggaactcttctcaagcctaacatggttacc |
368 |
Q |
| |
|
|||||||| ||||||| || |||||||| |||||||| ||||| | |||||||||||||||||| |
|
|
| T |
29237364 |
tacaaggccttgaatgaccaccatgtcctccttgaaggcactctcttgaagcctaacatggttacc |
29237299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University