View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14019_high_13 (Length: 354)
Name: NF14019_high_13
Description: NF14019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14019_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 335
Target Start/End: Original strand, 47116798 - 47117128
Alignment:
| Q |
1 |
tgttatttcatttccttatgatatctcnnnnnnnctgacattgttttgtttcatcgcttctcaggtaattacaatagttatattttatcaaagatattca |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116798 |
tgttatttcatttccttatgatatctctttttttctgacattgttttgtttcatcgcttctcaggtaattacaatagttatattttatcaaagatattca |
47116897 |
T |
|
| Q |
101 |
ataaccaatttcttttatatctttagtttcaattcaaggagataaatattcataccttttaacgatcaaatcacaaagcaaggtaagcaatatcaacgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116898 |
ataaccaatttcttttatatctttagtttcaattcaaggagataaatattcataccttttaacgatcaaatcacaaagcaaggtaagcaatatcaacgta |
47116997 |
T |
|
| Q |
201 |
tcaatgactcgatcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcggagaatgtatgataggcaacaaagctcaacggga |
300 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116998 |
tcaatgac----tcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcggagaatgtatgataggcaacaaagctcaacggga |
47117093 |
T |
|
| Q |
301 |
acgccaacatcaccatcttcgccggtgatgatgtc |
335 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| |
|
|
| T |
47117094 |
acgccaacatcaccgtcttcaccggtgatgatgtc |
47117128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University