View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1401_high_13 (Length: 341)
Name: NF1401_high_13
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1401_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 97 - 332
Target Start/End: Complemental strand, 42444285 - 42444050
Alignment:
| Q |
97 |
tatatatttatatgtaactttgtaagtaacactttttgctggctggcatggttatattatatatgtcatgattcatgtagtgtatatttattcttaagtc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42444285 |
tatatatttatatgtaactttgtaagtaacactttttgctggctagcatggttatattatatatgtcatgattcatgtggtgtatatttattcttaagtc |
42444186 |
T |
 |
| Q |
197 |
ggcaacaatgattagtatttgtttttaaaaggttgttgttgtcttgttgttcctacctaccatattctgtttagcttagtttgttgaaagattgcttcat |
296 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
42444185 |
ggcaacaatgactagtatttgtttttaaaaggttgttgttgtcttgttgttcctacctaccatattctgtttagcttagttttttggaagattgcttcat |
42444086 |
T |
 |
| Q |
297 |
ggattcgtggatattttcttgagttttaatctctgc |
332 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42444085 |
ggaatcgtggatattttcttgagttttaatctctgc |
42444050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University