View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1401_low_100 (Length: 209)
Name: NF1401_low_100
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1401_low_100 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 4 - 128
Target Start/End: Original strand, 17374983 - 17375107
Alignment:
| Q |
4 |
aaaataattgtgattttgtactaaataatatgattgtaaagttatgaaatagggatgtaatgaataatgtttagattgttttcttctctctttatttcga |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17374983 |
aaaataattgtgattttgtactaaataatatgattgtaaagttatgaaatagggatgtaatgaataatgtttagatttttttcttctctctttatttcgg |
17375082 |
T |
|
| Q |
104 |
ataaatctccgcgaccttcatttca |
128 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
17375083 |
ataaatctccgcgaccttcaattca |
17375107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University