View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1401_low_102 (Length: 206)
Name: NF1401_low_102
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1401_low_102 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 7e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 15634452 - 15634561
Alignment:
| Q |
1 |
aacttcaacctaaatggttgcgcaaatcacttaaaaataagacatacatttcatacaagtgctttacgaagcaatataagggtaataaatgagcatacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15634452 |
aacttcaacctaaatggttgcgcaaatcacttagaaataagacatacatttcatacaagtgctttacgaagtaatataagggtaataaatgagcatacaa |
15634551 |
T |
|
| Q |
101 |
agtataaatt |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
15634552 |
agtataaatt |
15634561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University