View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1401_low_103 (Length: 205)

Name: NF1401_low_103
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1401_low_103
NF1401_low_103
[»] chr7 (1 HSPs)
chr7 (1-128)||(44347733-44347860)


Alignment Details
Target: chr7 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 44347733 - 44347860
Alignment:
1 tagctacatcatggacctacattcacggtcacagtcacaaccggagtgtaattatttcattctaatttgccgagtggtgtaacgaacgacttcctttcaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44347733 tagctacatcatggacctacattcacggtcacagtcacaaccggagtgtaattatttcattctaatttgccgagtggtgtaacgaacgacttcctttcaa 44347832  T
101 cccacaaagataactttttcgcctatga 128  Q
    ||||||||||||||||||||||||||||    
44347833 cccacaaagataactttttcgcctatga 44347860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University