View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1401_low_29 (Length: 363)
Name: NF1401_low_29
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1401_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 101 - 281
Target Start/End: Complemental strand, 41735677 - 41735497
Alignment:
| Q |
101 |
cacgaggaacataattgtcgcatggtatgtgatcttacctcttttgttaagccttttttgtgataagatttatcaatggtgattacttctgtttcaactg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735677 |
cacgaggaacataattgtcgcatggtatgtgatcttacctcttttgttaagccttttttgtgataagatttatcaatggtgattacttctgtttcaactg |
41735578 |
T |
 |
| Q |
201 |
attcttgtaatcctttcatgatccatgtaactcctcagtgagggttcgacaacaaaggcatatggtagaataatattttcg |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735577 |
attcttgtaatcctttcatgatccatgtaacttctcagtgagggttcgacaacaaaggcatatggtagaataatattttcg |
41735497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University