View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1401_low_34 (Length: 338)
Name: NF1401_low_34
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1401_low_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 29 - 251
Target Start/End: Original strand, 19597474 - 19597693
Alignment:
| Q |
29 |
ggtagctccgttaaagattgcgttcttcttcgcaggaatgaaaatggccttggtggcagtgaagattgatgtggctgcagtgaagatggtggtttctctg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19597474 |
ggtagctccgttaaagattgcgttcttcttcgcaggaatgaaaacggccttcgtggcaatgaagattgctgtggctgcagtgaagatggtggtttctctg |
19597573 |
T |
|
| Q |
129 |
atgaagaaggtagtggtttctttgatgaagatggtggtgcattagaatcggatagttttggtggcggtggtggaggaggtggtggattcttggatgaaga |
228 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19597574 |
atgaaga---tagtgggttctttgatgaagatggtggtgcattagaatcggatagttttggtggcggtggtggaggaggtggtggattcttggatgaaga |
19597670 |
T |
|
| Q |
229 |
cggtggtgcattagaatgggata |
251 |
Q |
| |
|
|| ||||||||||||| ||||| |
|
|
| T |
19597671 |
tggcggtgcattagaatcggata |
19597693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 136 - 251
Target Start/End: Original strand, 19597647 - 19597762
Alignment:
| Q |
136 |
aggtagtggtttctttgatgaagatggtggtgcattagaatcggatagttttggtggcggtggtggaggaggtggtggattcttggatgaagacggtggt |
235 |
Q |
| |
|
|||| |||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19597647 |
aggtggtggattcttggatgaagatggcggtgcattagaatcggatagttttggtggcggtggtggaggaggtggtggattcttggatgaagatggtggt |
19597746 |
T |
|
| Q |
236 |
gcattagaatgggata |
251 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
19597747 |
gcattagaatcggata |
19597762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 136 - 245
Target Start/End: Original strand, 19597716 - 19597828
Alignment:
| Q |
136 |
aggtagtggtttctttgatgaagatggtggtgcattagaatcggatagttt---tggtggcggtggtggaggaggtggtggattcttggatgaagacggt |
232 |
Q |
| |
|
|||| |||| ||||| ||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| ||||| |||||||| ||| |
|
|
| T |
19597716 |
aggtggtggattcttggatgaagatggtggtgcattagaatcggatagttttggtggtggtggtggtggaggaggtggtgggttctttgatgaagatggt |
19597815 |
T |
|
| Q |
233 |
ggtgcattagaat |
245 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
19597816 |
ggtgcatcagaat |
19597828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 207
Target Start/End: Original strand, 19597788 - 19597859
Alignment:
| Q |
136 |
aggtagtggtttctttgatgaagatggtggtgcattagaatcggatagttttggtggcggtggtggaggagg |
207 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||| ||||| || | |||||||||| ||||| || ||||| |
|
|
| T |
19597788 |
aggtggtgggttctttgatgaagatggtggtgcatcagaattgggtggttttggtggtggtggagggggagg |
19597859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University