View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1401_low_4 (Length: 588)
Name: NF1401_low_4
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1401_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 167 - 459
Target Start/End: Complemental strand, 32875092 - 32874800
Alignment:
| Q |
167 |
catcaccaccaacattaacccttggacgattaactagttgagagggtttcattatacatccattgctaatctctctgttgttgatgagagcactcaaaga |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32875092 |
catcaccaccaacattaacccttggacgattaactagttgagagggtttcattatacatccattgctaatctctctgttattgatgagagcactcaaaga |
32874993 |
T |
|
| Q |
267 |
tacagaatttgtaaaagggctcaaaacatctcctataacaccaagagggtcgaccaaattttgtggcatgatattcttcttgatagatagatagatagat |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32874992 |
tacagaatttgtaaaagggctcaaaacatctcctataacaccaagagggtcgaccaaattttgtggcatgatattcttcttgatagatagatagatagat |
32874893 |
T |
|
| Q |
367 |
aattcaactggacctcgtttggtgttggcagcatgtttatgcatacacctgcacttatagataaattttgttcctttgtatctacctttgctt |
459 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32874892 |
aattcaaccggacctcgtttggtgttggcagcatgtttatgcatacacctgcacttatagataaattttgttcctttgtatctacttttgctt |
32874800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University