View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1401_low_43 (Length: 322)
Name: NF1401_low_43
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1401_low_43 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 78 - 322
Target Start/End: Original strand, 36097380 - 36097624
Alignment:
| Q |
78 |
gaaaagaagaagaaaaattacttgagagttgtcattagttaagatagaatgtatctattgtattagatttcaactaccgattgccatttgcctttctctg |
177 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36097380 |
gaaaagaagaaaaaaaattacttgagagttgtcattagttaagatagaatgtatctattgtattagatttcaactaccgattgccatttgcctttctctg |
36097479 |
T |
|
| Q |
178 |
tgtcaaagcctatagtgtacccaagagcatcccaatcagcgcttgtgcgaacaacgactttatatctacgcccatcaccttttagacggaactccaaacc |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36097480 |
tgtcaaagcctatagtgtacccaagagcatcccaatcagcgcttgtgcgaacaacgactttatatctacgcccatcaccttttagacggaactccaaacc |
36097579 |
T |
|
| Q |
278 |
atcatatgcagagagatcctccggttctgaaaaattctgaaaacc |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36097580 |
atcatatgcagagagatcctccggttctgaaaaattctgaaaacc |
36097624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University