View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1401_low_44 (Length: 322)
Name: NF1401_low_44
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1401_low_44 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 85 - 303
Target Start/End: Original strand, 13576490 - 13576713
Alignment:
| Q |
85 |
aggcgaaagggcttagatttagggtctagatgagattagttggatctataattagggttatgtccttaggtttgatgtatcttttgtgactttagtctga |
184 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
13576490 |
aggcgaaagggcttagatttagggtttagatgagattagcaggatctataattagggttgtgttcttaggtttgatgtatcttttgtgactttagtctga |
13576589 |
T |
|
| Q |
185 |
ttttctatg----tgttaagaaattgaatctaatggctgttttatgatgatgaatcttgaatgttattgggttcttttataaattctatgttaattttaa |
280 |
Q |
| |
|
||||| ||| |||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13576590 |
ttttcaatgtgtttgttaagaaatttaatctaatggcttttttatgatgatgaatcttgaatgttattgggttcttttataaatgctatgttaattttaa |
13576689 |
T |
|
| Q |
281 |
agctga-tttgtggtacgattttt |
303 |
Q |
| |
|
|||||| |||||||||| |||||| |
|
|
| T |
13576690 |
agctgattttgtggtacaattttt |
13576713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University