View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1401_low_46 (Length: 319)
Name: NF1401_low_46
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1401_low_46 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 112 - 319
Target Start/End: Complemental strand, 40690156 - 40689949
Alignment:
| Q |
112 |
gaagcaaaggcaaacttagattctctatgatcatcttcaggtgcaggaaggttgagatccaaatccaaagacaaaacattccttttctttctaggatgat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40690156 |
gaagcaaaggcaaacttagattctctatgatcatcttcaggtgcaggaaggttgagatccaaatccaaagacaaaacattccttttctttctaggatgat |
40690057 |
T |
 |
| Q |
212 |
cttcatcaggttccaaagccattggtgtcaaagagagtgtagtgttggctgcagatgttcccaccggcgcgcggtgacgcctcatatggccacctagtgc |
311 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |||||||||||||| ||||||||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
40690056 |
cttcatcaggttccaaagccattgttgtcaaagagagtgtggtgttggctgcagaagttcccaccggtgcacggtggcgcctcatatggccacctagtgc |
40689957 |
T |
 |
| Q |
312 |
ttgaccag |
319 |
Q |
| |
|
|||||||| |
|
|
| T |
40689956 |
ttgaccag |
40689949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 118 - 206
Target Start/End: Complemental strand, 34714448 - 34714363
Alignment:
| Q |
118 |
aaggcaaacttagattctctatgatcatcttcaggtgcaggaaggttgagatccaaatccaaagacaaaacattccttttctttctagg |
206 |
Q |
| |
|
||||||||||| | ||||| ||||| |||| || ||||||||||||||||||||||||||||| | |||||| ||||||||||||| |
|
|
| T |
34714448 |
aaggcaaacttgaactctctttgatcttcttaagctgcaggaaggttgagatccaaatccaaag---agacattcattttctttctagg |
34714363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 130 - 181
Target Start/End: Complemental strand, 34710740 - 34710689
Alignment:
| Q |
130 |
gattctctatgatcatcttcaggtgcaggaaggttgagatccaaatccaaag |
181 |
Q |
| |
|
|||||||| ||||| |||| || ||||||||||||||||||||||||||||| |
|
|
| T |
34710740 |
gattctctttgatcttcttaagctgcaggaaggttgagatccaaatccaaag |
34710689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University