View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1401_low_50 (Length: 312)
Name: NF1401_low_50
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1401_low_50 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 8e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 108 - 233
Target Start/End: Original strand, 36636155 - 36636281
Alignment:
| Q |
108 |
taggagagaaagatgtagaaataaatggtagtagtttgaatgaaaggggattaatgaataaaacaaatta-ttactaaaaatggaattttatggtgttgt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36636155 |
taggagagaaagatgtagaaataaatggtagtagtttgaatgaaaggggattaatgaataaaacaaattatttactaaaaatggaattttatggtgttgt |
36636254 |
T |
|
| Q |
207 |
aaaaatactaatcaatattaaccttca |
233 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
36636255 |
aaaaatactaatcaatattaaccttca |
36636281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University