View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1401_low_56 (Length: 302)
Name: NF1401_low_56
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1401_low_56 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 103 - 222
Target Start/End: Complemental strand, 10247495 - 10247376
Alignment:
| Q |
103 |
ctaaccatgtaataatttgcaaatatccactgaaatagtcaatgaataagaatgtannnnnnnncttctgaccatataataattcgcaaatatccaccga |
202 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10247495 |
ctaaccatgtaatgatttgcaaatatccactgaaatagtcaatgaataagaatgtatttttcttcttctgaccatataataattcgcaaatatccaccga |
10247396 |
T |
 |
| Q |
203 |
tgttgtcaatgataatctat |
222 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
10247395 |
tgttgtcaatgataatctat |
10247376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University