View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1401_low_57 (Length: 302)
Name: NF1401_low_57
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1401_low_57 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 80 - 298
Target Start/End: Original strand, 11109603 - 11109824
Alignment:
| Q |
80 |
agtgcatacataaccataaaaggagttgactaaattcgatttatgggcaatacatttcttatgcatgtacttccttattattattttttggctctnnnnn |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11109603 |
agtgcatacataaccataaaaggagttgactgaattcgatttatgggcaatacatttcttatgcatgtacttccttattattattttttggctctaaaaa |
11109702 |
T |
 |
| Q |
180 |
nntaacactaaccaacaatatatgtagggttggtctaaaggtaagactactaaaacctttgttctaggcc----cttgttaatttaataattgtcatatt |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
11109703 |
aataacactaaccaacaatatatgtagggttggtctaaaggtaagactactaaaacctttg-tctaggccctttcttgttaatttaataattgtcatatt |
11109801 |
T |
 |
| Q |
276 |
tgccaaagattaatagtgtcatt |
298 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
11109802 |
tgccaaagattaatagtgtcatt |
11109824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University