View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1401_low_63 (Length: 259)
Name: NF1401_low_63
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1401_low_63 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 29 - 252
Target Start/End: Complemental strand, 33466264 - 33466044
Alignment:
| Q |
29 |
acaaccttggtccgactcggttggcttggtggctagtcgggccaagcagactgatttaacaactctattcagaggtgatgtgtgtttcatttaaacaaac |
128 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33466264 |
acaaccttggtctgactcggttggcttggtggctagtcgggccaagcagactgatttaacaactctattaagaggtgatgtgtgtttcatttaaacaaac |
33466165 |
T |
|
| Q |
129 |
ccgaagggaggagagtgatacattgacaacaaataaaagtgctgagtttttgtttaaaaatagttgtagtgtgtgttattattcatgcatactttagggg |
228 |
Q |
| |
|
|| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33466164 |
cc-aaggg--gagagtgatacattgacaacaaataaaagtgctgagtttttgtttaaaaatagttgtagtgtgtgttattattcatgcatactttagggg |
33466068 |
T |
|
| Q |
229 |
agttaagtgtaatctttcaacaac |
252 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
33466067 |
agttaagtgcaatctttcaacaac |
33466044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University