View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1401_low_64 (Length: 255)
Name: NF1401_low_64
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1401_low_64 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 22 - 255
Target Start/End: Original strand, 24756864 - 24757097
Alignment:
| Q |
22 |
catcatcagaaacaacaacagaattaaaagaaacatctctatgaccctctaaaacacctttcaaagtatgcaaatttttcccttcttttccccatgcctt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24756864 |
catcatcagaaacaacaacagaattaaaagaaacatctctatgaccctctaaaacacctttcaaagtatgcaaatttttcccttcttttccccatgcctt |
24756963 |
T |
|
| Q |
122 |
aattttcccatctgcagaagcagaataaacaacccctttacatgctaccaacccattgatagcatcatcatgcgccttaatggattctaaacacttcaaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24756964 |
aattttcccatctgcagaagcagaataaacaatccctttacatgctaccaacccattgatagcatcatcatgcgccttaatggattctaaacacttcaaa |
24757063 |
T |
|
| Q |
222 |
tcagaaacactccaaacttttagtgtcttatccc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
24757064 |
tcagaaacactccaaacttttagtgtcttatccc |
24757097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University