View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1401_low_65 (Length: 253)
Name: NF1401_low_65
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1401_low_65 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 30 - 253
Target Start/End: Complemental strand, 24757357 - 24757134
Alignment:
| Q |
30 |
caaagcactagcaacttttggaaacaatgttttcactgctcatcaagatagcaagattcgtgtttggaaagtttctagaagttcagagaatgtgttcaag |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24757357 |
caaagcactagcaacttttggaaacaatgttttcactgctcatcaagatagcaagattcgtgtttggaaagtttctagaagttcagagaatgtgttcaag |
24757258 |
T |
 |
| Q |
130 |
ctcgtcgatacgcttccaacaacaaaagactatttggggaagtttatgaaacaaagtaattatgttcaaactaggagacatcacaagaggttatggattg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24757257 |
ctcgtcgatacgcttccaacaacaaaagactatttggggaagtttatgaaacaaagtaattatgttcaaactaggagacatcacaagaggttatggattg |
24757158 |
T |
 |
| Q |
230 |
aacatgctgatagcatttcttgtt |
253 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
24757157 |
aacatgctgatagcatttcttgtt |
24757134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University