View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1401_low_67 (Length: 251)
Name: NF1401_low_67
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1401_low_67 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 9 - 251
Target Start/End: Original strand, 33465635 - 33465877
Alignment:
| Q |
9 |
agcagagaatgagaatgatgaagaagcatttgcatttgatagagaattggagaaagaatcaaatgatatgcaaatgcaaaactcagttcctatgataagt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33465635 |
agcagagaatgagaatgatgaagaagcatttgcatttgatagagaattggagaaagaatcaaatgatatgcaaatgcaaaactcagttcctatgataagt |
33465734 |
T |
 |
| Q |
109 |
gaaatggatagcatgaaagtgtgtattgaagaagaggttgatcgcgtttatgacaggttacaagctcttgaaacagatagagagtttctccaacattgta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33465735 |
gaaatggatagcatgaaagtgtgtattgaagaagaggttgatcgcgtttatgacaggttacaagctcttgaaacagatagagagtttctccaacattgta |
33465834 |
T |
 |
| Q |
209 |
tgggatccatacaaaatggtggtgatgaaggaaaggatttgct |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33465835 |
tgggatccatacaaaatggtggtgatgaaggaaaggatttgct |
33465877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University