View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1401_low_71 (Length: 242)
Name: NF1401_low_71
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1401_low_71 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 86 - 150
Target Start/End: Complemental strand, 32993997 - 32993933
Alignment:
| Q |
86 |
atggctgggattaaaaatccacttaaaatgtcacgtgcccactggtgttgttcagcgtgtctcct |
150 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32993997 |
atggctgggattaaaactccacttaaaatgtcacgtgcccactggtgttgttcagcgtgtctcct |
32993933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 86 - 150
Target Start/End: Complemental strand, 24287588 - 24287524
Alignment:
| Q |
86 |
atggctgggattaaaaatccacttaaaatgtcacgtgcccactggtgttgttcagcgtgtctcct |
150 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24287588 |
atggctgggattaaaactccacttaaaatgtcacgtgcctactggtgttgttcagcgtgtctcct |
24287524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University