View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1401_low_74 (Length: 239)

Name: NF1401_low_74
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1401_low_74
NF1401_low_74
[»] chr3 (3 HSPs)
chr3 (8-118)||(22131766-22131873)
chr3 (51-118)||(18948970-18949037)
chr3 (51-118)||(21961096-21961163)


Alignment Details
Target: chr3 (Bit Score: 89; Significance: 5e-43; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 8 - 118
Target Start/End: Complemental strand, 22131873 - 22131766
Alignment:
8 agaaggtattcaaactgtatttactattattgacttaaggataggtttgtattatttgcttgttgccttagtggcaacaacgatagcgtttagtgcagct 107  Q
    ||||||||||| |||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22131873 agaaggtattcgaactgtatttactatta---acttaaggataggtttgtattatttgcttgttgccttagtggcaacaacgatagcgtttagtgcagct 22131777  T
108 ctgcctatgct 118  Q
    ||| |||||||    
22131776 ctgtctatgct 22131766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 51 - 118
Target Start/End: Original strand, 18948970 - 18949037
Alignment:
51 ggtttgtattatttgcttgttgccttagtggcaacaacgatagcgtttagtgcagctctgcctatgct 118  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||  |||||||||| |||||||    
18948970 ggtttgtattatttgcttattgccttagtggcaacaacgatagcgtttgctgcagctctgtctatgct 18949037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 51 - 118
Target Start/End: Complemental strand, 21961163 - 21961096
Alignment:
51 ggtttgtattatttgcttgttgccttagtggcaacaacgatagcgtttagtgcagctctgcctatgct 118  Q
    |||||||||| ||||||| ||||||||||||||||||||||||| |||| |||||||||| |||||||    
21961163 ggtttgtattttttgctttttgccttagtggcaacaacgatagcctttactgcagctctgtctatgct 21961096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University