View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1401_low_78 (Length: 223)

Name: NF1401_low_78
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1401_low_78
NF1401_low_78
[»] chr4 (2 HSPs)
chr4 (57-142)||(30519177-30519262)
chr4 (1-33)||(30519283-30519315)
[»] chr2 (1 HSPs)
chr2 (63-141)||(38897072-38897153)


Alignment Details
Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 57 - 142
Target Start/End: Complemental strand, 30519262 - 30519177
Alignment:
Q  57 agcaagaacaaattatgggataatcattccaaatggagatcaactttcttccaacctcatcatatgtgtcatcatacacctttgct 142  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30519262 agcaagaacaaattatgggataatcattccaaatggagatcaactttcttccaacctcatcatatgtgtcatcatacacctttgct 30519177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 30519315 - 30519283
Alignment:
Q  1 aatatagaaaaggttattggatgaaataggatt 33  Q
    |||||||||||||||||||||||||||||||||    
T  30519315 aatatagaaaaggttattggatgaaataggatt 30519283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 63 - 141
Target Start/End: Complemental strand, 38897153 - 38897072
Alignment:
Q  63 aacaaattatgggataatcattccaaatggagatcaactttcttcc----aacctcatcatatgtgtcatcatacacctttgc 141  Q
    ||||||||||| |||||||||||||||||||   |||||||||| |    |||||||||||||||||||||||||||||||||    
T  38897153 aacaaattatgagataatcattccaaatggatg-caactttcttgctatcaacctcatcatatgtgtcatcatacacctttgc 38897072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University