View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1401_low_84 (Length: 219)
Name: NF1401_low_84
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1401_low_84 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 80 - 169
Target Start/End: Original strand, 39974105 - 39974193
Alignment:
| Q |
80 |
tctcgaacaatattggtcttacctccagagtcaattctaacttgaaagctaaaaatggaagcttttgattttaaaattgattataacact |
169 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39974105 |
tctcgagcaaaattggtcttacctccagagtcaattctaacttgaa-gctaaaaatggaagcttttgattttaaaattgattataacact |
39974193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 98 - 161
Target Start/End: Original strand, 31515916 - 31515978
Alignment:
| Q |
98 |
ttacctccagagtcaattctaacttgaaagctaaaaatggaagcttttgattttaaaattgatt |
161 |
Q |
| |
|
||||||||||||||| |||||||||||| |||| | || ||||||||||||||||||||||||| |
|
|
| T |
31515916 |
ttacctccagagtcacttctaacttgaa-gctatagattgaagcttttgattttaaaattgatt |
31515978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 113 - 169
Target Start/End: Original strand, 44439256 - 44439311
Alignment:
| Q |
113 |
attctaacttgaaagctaaaaatggaagcttttgattttaaaattgattataacact |
169 |
Q |
| |
|
||||||||||||| ||||||| | | ||||||||||| ||||||||||| ||||||| |
|
|
| T |
44439256 |
attctaacttgaa-gctaaaatttggagcttttgattctaaaattgattttaacact |
44439311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University