View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1401_low_96 (Length: 212)

Name: NF1401_low_96
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1401_low_96
NF1401_low_96
[»] chr4 (1 HSPs)
chr4 (2-55)||(7653562-7653615)
[»] chr7 (1 HSPs)
chr7 (2-55)||(11362383-11362436)
[»] chr6 (1 HSPs)
chr6 (2-55)||(4059335-4059388)
[»] chr5 (1 HSPs)
chr5 (5-55)||(21905454-21905504)
[»] chr3 (1 HSPs)
chr3 (2-55)||(20592627-20592680)


Alignment Details
Target: chr4 (Bit Score: 54; Significance: 3e-22; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 2 - 55
Target Start/End: Original strand, 7653562 - 7653615
Alignment:
2 gatggtgtttcacggtggtttggggtctgagtttgggtttcacggtggtggttt 55  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7653562 gatggtgtttcacggtggtttggggtctgagtttgggtttcacggtggtggttt 7653615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 2 - 55
Target Start/End: Complemental strand, 11362436 - 11362383
Alignment:
2 gatggtgtttcacggtggtttggggtctgagtttgggtttcacggtggtggttt 55  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||    
11362436 gatggtgtttcacggtggtttggggtctgactttgggtttcacggtggtggttt 11362383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 2 - 55
Target Start/End: Complemental strand, 4059388 - 4059335
Alignment:
2 gatggtgtttcacggtggtttggggtctgagtttgggtttcacggtggtggttt 55  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||    
4059388 gatggtgtttcacggtggtttggggtctgactttgggtttcacggtggtggttt 4059335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 5 - 55
Target Start/End: Original strand, 21905454 - 21905504
Alignment:
5 ggtgtttcacggtggtttggggtctgagtttgggtttcacggtggtggttt 55  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||    
21905454 ggtgtttcacggtggtttggggtctgaatttgggtttcacggtggtggttt 21905504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 2 - 55
Target Start/End: Original strand, 20592627 - 20592680
Alignment:
2 gatggtgtttcacggtggtttggggtctgagtttgggtttcacggtggtggttt 55  Q
    ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||    
20592627 gatggtgtttcacggtggtttggggtctgagcttgggtttcacagtggtggttt 20592680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University