View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1401_low_96 (Length: 212)
Name: NF1401_low_96
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1401_low_96 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 54; Significance: 3e-22; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 2 - 55
Target Start/End: Original strand, 7653562 - 7653615
Alignment:
| Q |
2 |
gatggtgtttcacggtggtttggggtctgagtttgggtttcacggtggtggttt |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7653562 |
gatggtgtttcacggtggtttggggtctgagtttgggtttcacggtggtggttt |
7653615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 2 - 55
Target Start/End: Complemental strand, 11362436 - 11362383
Alignment:
| Q |
2 |
gatggtgtttcacggtggtttggggtctgagtttgggtttcacggtggtggttt |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11362436 |
gatggtgtttcacggtggtttggggtctgactttgggtttcacggtggtggttt |
11362383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 2 - 55
Target Start/End: Complemental strand, 4059388 - 4059335
Alignment:
| Q |
2 |
gatggtgtttcacggtggtttggggtctgagtttgggtttcacggtggtggttt |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4059388 |
gatggtgtttcacggtggtttggggtctgactttgggtttcacggtggtggttt |
4059335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 5 - 55
Target Start/End: Original strand, 21905454 - 21905504
Alignment:
| Q |
5 |
ggtgtttcacggtggtttggggtctgagtttgggtttcacggtggtggttt |
55 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21905454 |
ggtgtttcacggtggtttggggtctgaatttgggtttcacggtggtggttt |
21905504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 2 - 55
Target Start/End: Original strand, 20592627 - 20592680
Alignment:
| Q |
2 |
gatggtgtttcacggtggtttggggtctgagtttgggtttcacggtggtggttt |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
20592627 |
gatggtgtttcacggtggtttggggtctgagcttgggtttcacagtggtggttt |
20592680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University