View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1401_low_99 (Length: 211)
Name: NF1401_low_99
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1401_low_99 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 22 - 211
Target Start/End: Complemental strand, 37961959 - 37961770
Alignment:
| Q |
22 |
taacatggtaaaataatgaaccatgacacctgttttgaaacattactagttgctactagttgtttcagattactttttgaaagagaactttatcaatatg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37961959 |
taacatggtaaaataatgaaccatgacacctgttttgaaacattactagttgctactagttgtttcagattactttttgaaagagaactttatcgatatg |
37961860 |
T |
 |
| Q |
122 |
agagtaaatggtctctgggtcacaatatgcttcatagtaaaaactcttggccaccgcaaggaatgaattcttgatattggaatgcaagcc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37961859 |
agagtaaatggtctctgggtcacaatatgcttcatagtaaaaactcttggccaccgcaaggaatgaattcttgatattggaatgcaagcc |
37961770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 22 - 211
Target Start/End: Original strand, 12629838 - 12630027
Alignment:
| Q |
22 |
taacatggtaaaataatgaaccatgacacctgttttgaaacattactagttgctactagttgtttcagattactttttgaaagagaactttatcaatatg |
121 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
12629838 |
taacatggtaaaataatgaactgtgacacctgttttgaaacattactagttactactagttgtttcagataactttttgaaagagaactttattaatatg |
12629937 |
T |
 |
| Q |
122 |
agagtaaatggtctctgggtcacaatatgcttcatagtaaaaactcttggccaccgcaaggaatgaattcttgatattggaatgcaagcc |
211 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12629938 |
agagtaaatggtctctgcgtcacaatatgcttcatagtaaaaactcttggccaccgcaaggaatgaattcttgatattggaatgcaagcc |
12630027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 95 - 152
Target Start/End: Original strand, 31150511 - 31150568
Alignment:
| Q |
95 |
tttttgaaagagaactttatcaatatgagagtaaatggtctctgggtcacaatatgct |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | ||||||||| |||||| |
|
|
| T |
31150511 |
tttttgaaagagaactttatcaatatgagagtaaatggtttatgggtcacagtatgct |
31150568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 211
Target Start/End: Original strand, 31150572 - 31150614
Alignment:
| Q |
169 |
tggccaccgcaaggaatgaattcttgatattggaatgcaagcc |
211 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31150572 |
tggcaaccgcaaggaatgaattcttgatattggaaggcaagcc |
31150614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University