View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14023_high_34 (Length: 241)

Name: NF14023_high_34
Description: NF14023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14023_high_34
NF14023_high_34
[»] chr3 (1 HSPs)
chr3 (4-226)||(30785398-30785632)


Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 4 - 226
Target Start/End: Complemental strand, 30785632 - 30785398
Alignment:
4 tgtccgacacatgttagtgtgttgtctggtgtccgtatttttgttagtacttcgtggtgtgt------------tggtgtccgtgtctgtattagtgttc 91  Q
    |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||            ||||||||||||||||||||||||||    
30785632 tgtccgacacatgtcagtgtgttgtctggtgtccatatttttgttagtacttcgtggtgtgtatgtatcttggttggtgtccgtgtctgtattagtgttc 30785533  T
92 gtagatagctaatcataatgtaatttaacagtttgtagtttttaggagagaatttgaactccatttgttaaagttttattcttttttggttaacaaatga 191  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
30785532 gtagatagctaatcataatgtaatttaacagtttgtagtttttaggagagaatttgaactccatttgttcaagttttattcttttttggttaacaaatga 30785433  T
192 tgggtatggtttggtgatcaatgcagggtggaggt 226  Q
    |||||||||||||||||||||||||||||||||||    
30785432 tgggtatggtttggtgatcaatgcagggtggaggt 30785398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University