View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14023_low_19 (Length: 371)
Name: NF14023_low_19
Description: NF14023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14023_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 8e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 257 - 354
Target Start/End: Complemental strand, 29235954 - 29235857
Alignment:
| Q |
257 |
aactgaattgcatgtgcattatcattgaactgtgtgaacaaagaggatggccaatacccaactatttcagttccatatccaaaccaccagttcccatt |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29235954 |
aactgaattgcatgtgcattatcattgaactgtgtgaataaagaggatggccaatacccaactatttcagttccatatccaaaccaccagttcccatt |
29235857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 257 - 354
Target Start/End: Complemental strand, 29280687 - 29280590
Alignment:
| Q |
257 |
aactgaattgcatgtgcattatcattgaactgtgtgaacaaagaggatggccaatacccaactatttcagttccatatccaaaccaccagttcccatt |
354 |
Q |
| |
|
|||| |||| ||||||||||||| || |||| ||||||||| || ||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
29280687 |
aactcaatttcatgtgcattatccttcaactttgtgaacaaggaagatggccaatacccaactacttcagatccatatccaaaccaccagttcccatt |
29280590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 277 - 317
Target Start/End: Complemental strand, 40030352 - 40030312
Alignment:
| Q |
277 |
atcattgaactgtgtgaacaaagaggatggccaatacccaa |
317 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||| |||| |
|
|
| T |
40030352 |
atcatttaagtgtgtgaacaaagaggatggccaatatccaa |
40030312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University