View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14023_low_24 (Length: 326)
Name: NF14023_low_24
Description: NF14023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14023_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 31 - 317
Target Start/End: Original strand, 18544570 - 18544857
Alignment:
| Q |
31 |
atatcaattctgttc-atatgcagcttgttattttgatcaccttttgcccattcaacatcatataccggtcaagtcgtttcttctttatccggagtttat |
129 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18544570 |
atatcaattctgttccatatgcagcttgttattttgatcaccttttgcccattcaacatcatataccggtcaagtcgtttcttctttatccggagtttat |
18544669 |
T |
 |
| Q |
130 |
tccgctgcatatgtgctccatttttcacggtattttaacaactaggaaattaaaatttgaatgacacggttaaacacaaatatacttaatctagacacac |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18544670 |
tccgctgcatatgtgctccatttttcacggtattttaacaactaggaaattaaaatttgaatgacacggttaaatacaaatatacttaatctagacacac |
18544769 |
T |
 |
| Q |
230 |
ctaattattaatgacttttctttgcaggttacacttatggatttcttcttggctgatcagcttaccagtcaggtgtttctgtgctcct |
317 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18544770 |
ctaattaataatgacttttctttgcaggttacacttatggatttcttcttggctgatcagcttaccagtcaggtgtttctgtgctcct |
18544857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University