View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14023_low_26 (Length: 314)
Name: NF14023_low_26
Description: NF14023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14023_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 85 - 298
Target Start/End: Original strand, 20975982 - 20976207
Alignment:
| Q |
85 |
aacaagtaattgaaggattataaataacagaagaagcaaagaataaattgatcatataactagggactaaaggatcaaaagtggaatattgaaatgat-- |
182 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
20975982 |
aacaagtaattgaaggattctaaataacagaagaagcaaagaataaattgatcatataactagggactaaaggatcaaaagcggaatattgaaatgatga |
20976081 |
T |
 |
| Q |
183 |
---------gattgaagatttatatactgt-atgaaattgatgctacatagtcacacatttctaactagtggtacttgtatgaaatcaggtatggatatt |
272 |
Q |
| |
|
||||||||||||||||||| | || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20976082 |
ttgaagtaagattgaagatttatatactttgttggtgttgatgctacatagtcacacatttctaactagtggtacttgtatgaaatcaggtatggatatt |
20976181 |
T |
 |
| Q |
273 |
gtgcaatgattgtggtgtaaactctc |
298 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
20976182 |
gtgcaatgattgtggtgtaaactctc |
20976207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University