View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14023_low_28 (Length: 289)
Name: NF14023_low_28
Description: NF14023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14023_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 81; Significance: 4e-38; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 12 - 112
Target Start/End: Complemental strand, 32746001 - 32745901
Alignment:
| Q |
12 |
tacttgcagtctccgtttatgtatttgatgggattttctcttgttctgattttgtcgaaaataaagagcaaggcaaaactcggaagctgaagaaaatatt |
111 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| || |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32746001 |
tacttgcagtctccacttatgtatttgatgggattttctcttgttctgatttggtggaaaataaagagcaagacaaaactcggaagctgaagaaaatatt |
32745902 |
T |
|
| Q |
112 |
g |
112 |
Q |
| |
|
| |
|
|
| T |
32745901 |
g |
32745901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 169 - 271
Target Start/End: Complemental strand, 32745852 - 32745754
Alignment:
| Q |
169 |
taatgagcttttgtactacaaaagtggtatcatatggtatttggaggactcttagtcagaacttggagcaaagtagttagtgactaactgaagaatggaa |
268 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| | ||||||||||||||| | |||||||||||||| || |||| ||||| ||||||||||||||| |
|
|
| T |
32745852 |
taatgagcttttgtactacaaaagtggtgtcatgttgtatttggaggactc--aatcagaacttggagctaa--agttggtgacgaactgaagaatggaa |
32745757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 14 - 106
Target Start/End: Original strand, 3287422 - 3287514
Alignment:
| Q |
14 |
cttgcagtctccgtttatgtatttgatgggattttctcttgttctgattttgtcgaaaataaagagcaaggcaaaactcggaagctgaagaaa |
106 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| || ||||||||||| |
|
|
| T |
3287422 |
cttgcagtctccgcttatgtctttgatgggattttctcttgttctgatttggtcgaaaataaagagcaagaaaaaacatggcagctgaagaaa |
3287514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University