View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14023_low_35 (Length: 254)
Name: NF14023_low_35
Description: NF14023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14023_low_35 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 16 - 254
Target Start/End: Original strand, 53459230 - 53459469
Alignment:
| Q |
16 |
atgaatacaattacaccaacttcatatgaaaatgcaattgtatgcatggagacaaaatatattcccaaaacagtagaagtactattgtgtgtgttatgtg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
53459230 |
atgaatacaattacaccaacttcatatgaaaatgcaattgtatgcatggagacaaaatatattcccaaaacaatagaagtactattgtgtgtgttatgtg |
53459329 |
T |
|
| Q |
116 |
caatatctgtttctgtgggtgcaaattctttctctgcaatgtgtattttatgtgcatatt-gatcaacccatgcggtttctttaattatgtgattaaaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53459330 |
caatatctgtttctgtgggtgcaaattctttctctgcaatgtgtattttatgtgcatattggatcaacccatgcggtttctttaattatgtgattaaaaa |
53459429 |
T |
|
| Q |
215 |
tgatttgtagggataatcctgtgattcaataggcctattc |
254 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
53459430 |
tgatttgtagggataatcctgtgactcaataggcctattc |
53459469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University