View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14023_low_38 (Length: 250)
Name: NF14023_low_38
Description: NF14023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14023_low_38 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 7 - 250
Target Start/End: Complemental strand, 30785921 - 30785678
Alignment:
| Q |
7 |
tatattatactatacaagtttatattcatgaatcannnnnnnnctcttattcaagtttaataattttcactctactactcttcacagggaaccaatccaa |
106 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30785921 |
tatactatactatacaagtttatattcatgaatcattttttttctcttattcaagtttaataattttcactctactactcttcacagggaaccaatccaa |
30785822 |
T |
 |
| Q |
107 |
aacaaaatcaccaagcatctcagaaactcacattatcattgggtgaatcagtgtctagtgcagctctagttgctcttctatctgcttctctcttctttgt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30785821 |
aacaaaatcaccaagcatctcagaaactcgcattatcattgggtgaatcagtgtctagtgcagctctagttgctcttctatctgcttctctcttctttgt |
30785722 |
T |
 |
| Q |
207 |
tgatcctgcacttgcattcaaggtatatacttaatactattact |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30785721 |
tgatcctgcacttgcattcaaggtatatacttaatactattact |
30785678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University