View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14023_low_40 (Length: 241)
Name: NF14023_low_40
Description: NF14023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14023_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 4 - 226
Target Start/End: Complemental strand, 30785632 - 30785398
Alignment:
| Q |
4 |
tgtccgacacatgttagtgtgttgtctggtgtccgtatttttgttagtacttcgtggtgtgt------------tggtgtccgtgtctgtattagtgttc |
91 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30785632 |
tgtccgacacatgtcagtgtgttgtctggtgtccatatttttgttagtacttcgtggtgtgtatgtatcttggttggtgtccgtgtctgtattagtgttc |
30785533 |
T |
 |
| Q |
92 |
gtagatagctaatcataatgtaatttaacagtttgtagtttttaggagagaatttgaactccatttgttaaagttttattcttttttggttaacaaatga |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30785532 |
gtagatagctaatcataatgtaatttaacagtttgtagtttttaggagagaatttgaactccatttgttcaagttttattcttttttggttaacaaatga |
30785433 |
T |
 |
| Q |
192 |
tgggtatggtttggtgatcaatgcagggtggaggt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
30785432 |
tgggtatggtttggtgatcaatgcagggtggaggt |
30785398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University