View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14023_low_43 (Length: 236)
Name: NF14023_low_43
Description: NF14023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14023_low_43 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 90 - 223
Target Start/End: Complemental strand, 32904590 - 32904457
Alignment:
| Q |
90 |
ttaatccaacgagcttggaatggacaatgattccaaacttcaaatcagatgcatattgaatgctttctattaataatttggagtccatatnnnnnnntat |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32904590 |
ttaatccaacgagcttggaatggacaatgattccaaacttcaaatcagatgcatattgaatgctttctattaataatttggagtccatataataaaatat |
32904491 |
T |
|
| Q |
190 |
aaggctatttatttttccaccctcccttcatctc |
223 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
32904490 |
aaggctatttatttttccaccctcccttcttctc |
32904457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University