View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14023_low_45 (Length: 233)
Name: NF14023_low_45
Description: NF14023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14023_low_45 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 13 - 233
Target Start/End: Complemental strand, 53459770 - 53459548
Alignment:
| Q |
13 |
aaaattatatcaacatttttcaagttttcatgtcatttt--gtatagggacattgcctccaagtaaacccatgtttgaagctaaaaccgatgtgactaac |
110 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53459770 |
aaaattatatcgacatttttcaagttttcatgtcattttttgtatagggacattgcctccaagtaaacccatgtttgaagctaaaaccgatgtgactaac |
53459671 |
T |
 |
| Q |
111 |
agatttaaggagtgcatcaaccataaaatcgaagtccattttcctatagaaaaatacttttactctaaacgtactttgccaactttaaacctgaaatgcc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53459670 |
agatttaaggagtgcatcaaccataaaatcgaagtccattttcctatagaaaaatacttttactctaaacttactttgccaactttaaacctgaaatgcc |
53459571 |
T |
 |
| Q |
211 |
caaacatgcaattaatagtactc |
233 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
53459570 |
caaacatgcaattaatagtactc |
53459548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University