View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14024_high_3 (Length: 444)
Name: NF14024_high_3
Description: NF14024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14024_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 258; Significance: 1e-143; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 19 - 311
Target Start/End: Complemental strand, 48237051 - 48236762
Alignment:
| Q |
19 |
tgtacgtgaaaccatatgttttatctctatatcttcttcttcaacttgcacagatttgaaaaataaatacaaaaagcaaatgacannnnnnncgaaatca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48237051 |
tgtacgtgaaaccatatgttttatctctatatcttcttc---aacttgcacagatttgaaaaataaatacaaaaagcaaatgacatttttttcgaaatca |
48236955 |
T |
 |
| Q |
119 |
aattttttgatgtaaaacaataatttttcttgttaccaggcagaacaaattcgtagatggaaagaggaagagggacgaaaggttgtggaagttaggttat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48236954 |
aattttttgatgtaaaacaataatttttcttgttaccaggcagaacaaattcgtagatggaaagaggaagagggacgaaaggttgtggaagttaggttat |
48236855 |
T |
 |
| Q |
219 |
ctcaggaggcagctctagcaatagcagaaagggagaaggctaaagccaaagctgcattggaagcagcagaggaagccaagaggaaggctgaac |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48236854 |
ctcaggaggcagctctagcaatagcagaaagggagaaggctaaagccaaagctgcattggaagcagcagaggaagccaagaggaaggctgaac |
48236762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 373 - 430
Target Start/End: Complemental strand, 48236700 - 48236643
Alignment:
| Q |
373 |
taaagtattgaatgcattggctcaaaatgataatcgatatagaaaatacacgatgatg |
430 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48236700 |
taaagtattgaatgcattggctcaaaatgataatcgatatagaaaatacactatgatg |
48236643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University