View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14024_high_9 (Length: 231)
Name: NF14024_high_9
Description: NF14024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14024_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 13 - 167
Target Start/End: Original strand, 47702198 - 47702352
Alignment:
| Q |
13 |
aagaatatccagagcgagcttagttaagggatcatcacgttcagttgcaaacactgaagcgcaaaaagccttgattgctcactggcagggaatagtcaag |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47702198 |
aagaacatccagagcgagcttagttaagggatcatcacgttcagttgcaaacactgaagcgcaaaaagccttgattgctcactggcagggaatagtcaag |
47702297 |
T |
 |
| Q |
113 |
agccttggaaacttcttaaatactttgaaagcaaataatgttagtggaacctctt |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47702298 |
agccttggaaacttcttaaatactttgaaagcaaataatgttagtggaacctctt |
47702352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University