View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14024_low_10 (Length: 215)
Name: NF14024_low_10
Description: NF14024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14024_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 48606045 - 48605865
Alignment:
| Q |
19 |
gagggtagagttgaagttgtgagtggcaaagggtgttcgaggctgttttcgtcttcaatcagaaatcttcaaccattggaccaaatgtctcctgtttcat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48606045 |
gagggtagagttgaagttgtgagtggcaaagggtgttcgaggctgttttcgtcttcaatcagaaatcttcaaccattggaccaaatgtctcctgtttcat |
48605946 |
T |
 |
| Q |
119 |
cctctccgcaattgccatcaaatgctccttttgctggtcttgttatatgtgttactggtttatctaaaggtgtggattcat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48605945 |
cctctccgcaattgccatcaaatgctccttttgctggtcttgttatatgtgttactggtttatctaaaggtgtggattcat |
48605865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University