View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14024_low_3 (Length: 444)

Name: NF14024_low_3
Description: NF14024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14024_low_3
NF14024_low_3
[»] chr3 (2 HSPs)
chr3 (19-311)||(48236762-48237051)
chr3 (373-430)||(48236643-48236700)


Alignment Details
Target: chr3 (Bit Score: 258; Significance: 1e-143; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 19 - 311
Target Start/End: Complemental strand, 48237051 - 48236762
Alignment:
19 tgtacgtgaaaccatatgttttatctctatatcttcttcttcaacttgcacagatttgaaaaataaatacaaaaagcaaatgacannnnnnncgaaatca 118  Q
    |||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||       ||||||||    
48237051 tgtacgtgaaaccatatgttttatctctatatcttcttc---aacttgcacagatttgaaaaataaatacaaaaagcaaatgacatttttttcgaaatca 48236955  T
119 aattttttgatgtaaaacaataatttttcttgttaccaggcagaacaaattcgtagatggaaagaggaagagggacgaaaggttgtggaagttaggttat 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48236954 aattttttgatgtaaaacaataatttttcttgttaccaggcagaacaaattcgtagatggaaagaggaagagggacgaaaggttgtggaagttaggttat 48236855  T
219 ctcaggaggcagctctagcaatagcagaaagggagaaggctaaagccaaagctgcattggaagcagcagaggaagccaagaggaaggctgaac 311  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48236854 ctcaggaggcagctctagcaatagcagaaagggagaaggctaaagccaaagctgcattggaagcagcagaggaagccaagaggaaggctgaac 48236762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 373 - 430
Target Start/End: Complemental strand, 48236700 - 48236643
Alignment:
373 taaagtattgaatgcattggctcaaaatgataatcgatatagaaaatacacgatgatg 430  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
48236700 taaagtattgaatgcattggctcaaaatgataatcgatatagaaaatacactatgatg 48236643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University